View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_70 (Length: 285)

Name: NF0841_low_70
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_70
NF0841_low_70
[»] chr7 (2 HSPs)
chr7 (40-166)||(36326720-36326846)
chr7 (159-278)||(36326574-36326693)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 36326846 - 36326720
Alignment:
40 tactagtattcacaggtggaattgttagttgatttattttaggcttaataaaaatgctatctttaatttatgtttaagcggataaggtagtggcaaagaa 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36326846 tactagtattcacaggtggaattgttagttgatttattttaggcttaataaaaatgctatctttaatttatgtttaagcggataaggtagtggcaaagaa 36326747  T
140 gaatatgatatcttggacatttatttt 166  Q
    |||||||||||||||||||||||||||    
36326746 gaatatgatatcttggacatttatttt 36326720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 159 - 278
Target Start/End: Complemental strand, 36326693 - 36326574
Alignment:
159 tttattttgatgaattgttttttggcctagtgaatgtgagttgactatggtcgtaagctttaacaattgatgttttcgatgcgaattggaccatatagta 258  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||    
36326693 tttattttgatgaattgttttttggccgagtgaatgtgagttgactatggtcataagctttaacaattgatgttttagatgcgaattggatcatatagta 36326594  T
259 tttaagttgaattcatctca 278  Q
    ||||||||||| || |||||    
36326593 tttaagttgaactcttctca 36326574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2560 times since January 2019
Visitors: 6164