View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_72 (Length: 277)

Name: NF0841_low_72
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_72
NF0841_low_72
[»] chr4 (1 HSPs)
chr4 (13-142)||(25713662-25713795)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 13 - 142
Target Start/End: Original strand, 25713662 - 25713795
Alignment:
13 ttcttatatttcacttatttccacctgctcctctttgtttgtccctctgcctcactatcaacctttgttatcccttattttccactgttgatcccctc-- 110  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |      
25713662 ttcttatatttcacttatttccacctgctcctctttgtttgcccctctgcctcactatcaacctttgttatcccttattttccactgttgatcccccctc 25713761  T
111 --atgcacctcatcatcttatcttttgtgcttct 142  Q
      ||||||||||||||||||||||||||||||||    
25713762 atatgcacctcatcatcttatcttttgtgcttct 25713795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1061 times since January 2019
Visitors: 6135