View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_76 (Length: 270)

Name: NF0841_low_76
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_76
NF0841_low_76
[»] chr5 (2 HSPs)
chr5 (50-154)||(39583199-39583303)
chr5 (204-270)||(39583088-39583154)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 50 - 154
Target Start/End: Complemental strand, 39583303 - 39583199
Alignment:
50 tggtgtgacattctcatctcttgtgccagccagcaatgataacatgtgcttttgcattggagacagagagaaggactaaaacaaaacatgttctatgtgt 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
39583303 tggtgtgacattctcatctcttgtgccagccagcaatgataacatgtgcttttgcattggaggcagagagaaggactaaaacaaaacatgttctatgtgt 39583204  T
150 gaaac 154  Q
    |||||    
39583203 gaaac 39583199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 204 - 270
Target Start/End: Complemental strand, 39583154 - 39583088
Alignment:
204 tttcttgcactcatatcatatgcaaatatactattgacgtgcgtctgtagttgaaaatttgaacata 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39583154 tttcttgcactcatatcatatgcaaatatactattgacgtgcgtctgtagttgaaaatttgaacata 39583088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 384 times since January 2019
Visitors: 6128