View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0841_low_88 (Length: 251)
Name: NF0841_low_88
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0841_low_88 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 2332408 - 2332181
Alignment:
| Q |
1 |
atctttaatcctttccatagttacaggcaagagaagctggtccatcaagttaatgctaagagatggaatattatccagttgtaaactatatgagaggttt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332408 |
atctttaatcctttccatagtgacaggcaagagaagctggtccatcaagctaatgccaagagatggaatattatccagttgtaaactatatgagaggttt |
2332309 |
T |
|
| Q |
101 |
acagggatcatttgattggaatagattcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaacca |
200 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2332308 |
acagggatcatttgattgggatagatgcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcacc--atgttttccacattcaaacca |
2332211 |
T |
|
| Q |
201 |
gaaattttatttcgtcgtcttctgatgatg |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |
|
|
| T |
2332210 |
gaaattttatttcgccgtcttctgatgatg |
2332181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3198 times since January 2019
Visitors: 6172