View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_89 (Length: 251)

Name: NF0841_low_89
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_89
NF0841_low_89
[»] chr6 (1 HSPs)
chr6 (5-218)||(2332388-2332601)
[»] chr1 (1 HSPs)
chr1 (20-134)||(1261795-1261909)
[»] scaffold0244 (1 HSPs)
scaffold0244 (20-134)||(16490-16604)


Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 218
Target Start/End: Original strand, 2332388 - 2332601
Alignment:
5 actatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcata 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2332388 actatggaaaggattaaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcata 2332487  T
105 ttgttgggcatgatgtatgggaaatggtgtctgcctgtttggtgctttttcttccggcgttattgatcatactcttgtagagaccttggttgttctcatc 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2332488 ttgttgggcatgatgtatgggaaatggtgtctgcctgtttggtgctttttcttccggcgttattgatcatactcttgtagagaccttggttgttctcatc 2332587  T
205 ccgaaaattgatat 218  Q
    | ||||||||||||    
2332588 ctgaaaattgatat 2332601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 1261909 - 1261795
Alignment:
20 aaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcatattgttgggcatgatg 119  Q
    |||||| |||||||| | |||||||||||||||||||  || |  ||||| |||||||| || |||| ||||| || |||||||||||||||| ||||||    
1261909 aaagatgctattttctcaatgcactcttacaaagccccgggtccagatggttttcaacctatttttttcaaaacttattggcatattgttggggatgatg 1261810  T
120 tatgggaaatggtgt 134  Q
    | ||| |||||||||    
1261809 tgtggaaaatggtgt 1261795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0244 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0244
Description:

Target: scaffold0244; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 16604 - 16490
Alignment:
20 aaagattctattttccctatgcactcttacaaagccctaggacatgatggatttcaaccgatattttacaaaatttgttggcatattgttgggcatgatg 119  Q
    |||||| |||||||| | ||||||| |||||||||||  || |  ||||| |||||||| || |||| ||||  || |||||||| ||||||| ||||||    
16604 aaagatgctattttctcaatgcacttttacaaagccccgggtccagatggttttcaacctatttttttcaaagcttattggcatagtgttggggatgatg 16505  T
120 tatgggaaatggtgt 134  Q
    | ||| |||||||||    
16504 tctggaaaatggtgt 16490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1764 times since January 2019
Visitors: 6149