View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0842_high_4 (Length: 251)
Name: NF0842_high_4
Description: NF0842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0842_high_4 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 7385731 - 7385968
Alignment:
Q |
14 |
atatataagtaagaagtctcataaactctaaagtatttagattttaggtaaagatgttgtgtccaactcacttgtataccgttactcttggcgaaatgtg |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
7385731 |
atatataagtaagaagtctcataaactctaaagtatttagattttaggtaaagatgttgtatccaaatcacttgtataccgttactcttggcgaaatgtg |
7385830 |
T |
 |
Q |
114 |
gatgatcctctaggttaccgttgtgatccaacagtggtataagaaccgatggttcaacttgcgtttaatcgactctttgtgtcgaaagtctttctaacaa |
213 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
T |
7385831 |
gatgatcccctaggttaccgttgtgatccaacagtggtataagaaccgatggttcaacttgcgttcaatcgactctttgtgtcgaaagtctttttaacaa |
7385930 |
T |
 |
Q |
214 |
tgatggtcagggagacgtattccgttgacgcaacaaca |
251 |
Q |
|
|
||||||| ||||||||||||| |||||||||||||||| |
|
|
T |
7385931 |
tgatggttagggagacgtatttcgttgacgcaacaaca |
7385968 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University