View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0842_low_4 (Length: 323)
Name: NF0842_low_4
Description: NF0842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0842_low_4 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 96 - 323
Target Start/End: Original strand, 24720147 - 24720383
Alignment:
| Q |
96 |
ctacccacccgtacataagagcatatattgtcctagatgtcgatctttgattcaatttttca---------aaagcgaatatctttcctgcaatgtttct |
186 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24720147 |
ctacccatccgtacataagagcatatattgtcctagatgtcgatctttgattcaatttttcaaaagattcaaaagcgaatatctttcctgcaatgtttct |
24720246 |
T |
|
| Q |
187 |
ccacttttctgaatggtaatttttagtcagatcttttagaagataaaaaacttggtttggataaaaattgcagctatatataataattttcctttcttga |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
24720247 |
ccacttttctgaatggtaatttttagtcagatcttttagaagataaaaaacttggtttggataaaaattgcagctatatataataattttcccttctcga |
24720346 |
T |
|
| Q |
287 |
tgtgttgctacctaccccctcccccaaacaaatgttc |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24720347 |
tgtgttgctacctaccccctcccccaaacaaatgttc |
24720383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 209 - 316
Target Start/End: Original strand, 24728853 - 24728960
Alignment:
| Q |
209 |
ttagtcagatcttttagaagataaaaaacttggtttggataaaaattgcagctatatataataattttcctttcttgatgtgttgctacctaccccctcc |
308 |
Q |
| |
|
||||||||| ||| ||||||| ||||| | | ||| |||||||||||| |||||||||| ||| |||| || || |||| |||||||||||||||||| |
|
|
| T |
24728853 |
ttagtcagagatttgagaagattaaaaagtagaattgaataaaaattgcatctatatataagaatattccattttttatgttttgctacctaccccctcc |
24728952 |
T |
|
| Q |
309 |
cccaaaca |
316 |
Q |
| |
|
|||||||| |
|
|
| T |
24728953 |
cccaaaca |
24728960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 576 times since January 2019
Visitors: 6130