View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0842_low_8 (Length: 255)
Name: NF0842_low_8
Description: NF0842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0842_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 24720377 - 24720621
Alignment:
| Q |
1 |
aatgttcacaatcttttggaaagctaaacttttagacttttcaaatgcaagggtaataatgaagatttccttggaatccatgtattataagtttttgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24720377 |
aatgttcacaatcttttggaaagctaaacttttagacttttcaaatgcaagggtaataatgaagatttccttggaatccatgtattataagtttttgtaa |
24720476 |
T |
|
| Q |
101 |
tgaattgaacttgtagtagtgtagacagacactattacacacaaaatgcatgttctgttctgcaattcagttttgaaggttaattt-aaaattttataat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24720477 |
tgaattgaacttgtagtagtgtagacagacactattacacacaaaatgcatgttctgttctgcaattcagttttgaaggttaatttaaaaattttataat |
24720576 |
T |
|
| Q |
200 |
attatttctttacaatgtgaagggcattacttaagtgcaacagct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24720577 |
attatttctttacaatgtgaagggcattacttaagtgcaacagct |
24720621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 146 times since January 2019
Visitors: 6125