View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0842_low_9 (Length: 251)
Name: NF0842_low_9
Description: NF0842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0842_low_9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 7385731 - 7385968
Alignment:
| Q |
14 |
atatataagtaagaagtctcataaactctaaagtatttagattttaggtaaagatgttgtgtccaactcacttgtataccgttactcttggcgaaatgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7385731 |
atatataagtaagaagtctcataaactctaaagtatttagattttaggtaaagatgttgtatccaaatcacttgtataccgttactcttggcgaaatgtg |
7385830 |
T |
|
| Q |
114 |
gatgatcctctaggttaccgttgtgatccaacagtggtataagaaccgatggttcaacttgcgtttaatcgactctttgtgtcgaaagtctttctaacaa |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7385831 |
gatgatcccctaggttaccgttgtgatccaacagtggtataagaaccgatggttcaacttgcgttcaatcgactctttgtgtcgaaagtctttttaacaa |
7385930 |
T |
|
| Q |
214 |
tgatggtcagggagacgtattccgttgacgcaacaaca |
251 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
7385931 |
tgatggttagggagacgtatttcgttgacgcaacaaca |
7385968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1075 times since January 2019
Visitors: 6137