View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0843_high_4 (Length: 407)
Name: NF0843_high_4
Description: NF0843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0843_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 3 - 386
Target Start/End: Complemental strand, 10398195 - 10397812
Alignment:
| Q |
3 |
catctccaacaatatcataggtctattaccaattcacgttcttcagctgctacgaaattggttcagtctagtgtcaattcattatctagaggaaattcaa |
102 |
Q |
| |
|
|||| ||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10398195 |
catcaccaacaacatcataggtctattagcaattcacgttcttcagctgctacaaaattggttcagtctagtgtcaattcattatctagaggaaattcaa |
10398096 |
T |
 |
| Q |
103 |
tttcttcgaattcgcattcacatgatgatattggtattagttgtagcacacaatcacttcctgaactgcgttccgagagtgatagtgatagggaggtttt |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10398095 |
tttctttgaattcgcattcacatgatgatattggtattagttgtagcacacaatcacttcctgaactgcgttccgagagtgatagtgatagggaggtttt |
10397996 |
T |
 |
| Q |
203 |
aatacagcagcaatctaatgtgaacaatggatccgtggctgaaaagattggtaataacaatttgtcacgttcggttagtttgagttcttctgggattgat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10397995 |
aatacagcagcaatctaatgtgaacaatggatccgtggctgaaaagattggtaataacaatttgtcacgttcggttagtttgagttcttctgggattgat |
10397896 |
T |
 |
| Q |
303 |
catttgttggtaagagggtcagagaggcaacatgcttctgttacaaagccgccggtggctccgcaattttcgaaacctgtggtg |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10397895 |
catttgttggtaagagggtcagagaggcaacatgcttctgttacaaagccgccggtggctccgcaatttgcgaaacctgtggtg |
10397812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University