View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0843_low_15 (Length: 333)
Name: NF0843_low_15
Description: NF0843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0843_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 104 - 257
Target Start/End: Complemental strand, 25585937 - 25585782
Alignment:
Q |
104 |
gctaccattagttagttgaataaatacctaagaatttcttcggctgtg--aaatatttctcaattattatgagaccagctgttttttatgtacatcgatg |
201 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
T |
25585937 |
gctagcattagttagttgaataaatacctaagagtttcttcagctgtgtgaaatatttctcaattattatgagaccagctgttttttatgtacattgcag |
25585838 |
T |
 |
Q |
202 |
acaactatagaagaaagtaagggatcagatgctccactaatatcagcacctatgct |
257 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
25585837 |
acaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgct |
25585782 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 252
Target Start/End: Complemental strand, 25600373 - 25600322
Alignment:
Q |
201 |
gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacct |
252 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25600373 |
gacaactatcgaagaaagtaagggatcagatgctccactaatatcagcacct |
25600322 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 201 - 252
Target Start/End: Complemental strand, 25590721 - 25590670
Alignment:
Q |
201 |
gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacct |
252 |
Q |
|
|
||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25590721 |
gacaactatcgaggaaagtaagggatcagatgctccactaatatcagcacct |
25590670 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University