View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0843_low_16 (Length: 333)
Name: NF0843_low_16
Description: NF0843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0843_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 9e-64; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 104 - 260
Target Start/End: Complemental strand, 25585937 - 25585779
Alignment:
Q |
104 |
gctaccattagttagttgaataaatacctaagaatttcttcggctgtg--aaatatttctcaattattatgagaccagctgttttttatgtacatcgatg |
201 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
T |
25585937 |
gctagcattagttagttgaataaatacctaagagtttcttcagctgtgtgaaatatttctcaattattatgagaccagctgttttttatgtacattgcag |
25585838 |
T |
 |
Q |
202 |
acaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgcttct |
260 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25585837 |
acaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgcttct |
25585779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 201 - 253
Target Start/End: Complemental strand, 25600373 - 25600321
Alignment:
Q |
201 |
gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctt |
253 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25600373 |
gacaactatcgaagaaagtaagggatcagatgctccactaatatcagcacctt |
25600321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 253
Target Start/End: Complemental strand, 25590721 - 25590669
Alignment:
Q |
201 |
gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctt |
253 |
Q |
|
|
||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25590721 |
gacaactatcgaggaaagtaagggatcagatgctccactaatatcagcacctt |
25590669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1720 times since January 2019
Visitors: 6149