View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0843_low_24 (Length: 270)
Name: NF0843_low_24
Description: NF0843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0843_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 44189964 - 44190190
Alignment:
| Q |
15 |
gaaagcgagaatgaatgtgcttgagaagtatctttgaatgaactaatcaaatattatttcaaatgcatgnnnnnnncgactctaaggcggtgatgatgag |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44189964 |
gaaagcgagaatgaatgtgcttgaggagtatctttgaatgaactaatcaaatattatttcaaatgcatgtttttttcgactctaaggcggtgatgatgag |
44190063 |
T |
|
| Q |
115 |
ttgatgacagacaactgtgatgaaaaattgcattaacatatgactttgacagagaccaactcctaaggcacttcaaaagtagcaaggactatgttgttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44190064 |
ttgatgacagacaactgtgatgaaaaattgcattaacatatgactttgacagagaccaactcctaaggcacttcaaaagtagcaaggactatgttgttca |
44190163 |
T |
|
| Q |
215 |
atcgcgacgatgacagattgtacatac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44190164 |
atcgcgacgatgacagattgtacatac |
44190190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 372 times since January 2019
Visitors: 6128