View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0843_low_7 (Length: 398)
Name: NF0843_low_7
Description: NF0843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0843_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 86 - 247
Target Start/End: Original strand, 44678957 - 44679118
Alignment:
| Q |
86 |
aacaagacttaaggaaggaataactgacctgatcaaatgaaattttggggcggagaaaccaactcggtcaagtcaaacgaaacttggggagcatgaaatt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44678957 |
aacaagacttaaggaaggaataactgacccgatcaaatgaaattttggggcggagaaaccaactcggtcaagtcaaacgaaacttggggagcatgaaatt |
44679056 |
T |
|
| Q |
186 |
gatggaaacttagggtacatgatacatgggcaaaacatgccggaagaaatacacacaaaatt |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44679057 |
gatggaaacttagggtgcatgatacatgggcaaaacatgccggaagaaatacacacgaaatt |
44679118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 263 - 298
Target Start/End: Original strand, 44679129 - 44679164
Alignment:
| Q |
263 |
ttatacatttttctagtactaaaaatttaccatata |
298 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44679129 |
ttatacatttttcgagtactaaaaatttaccatata |
44679164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 816 times since January 2019
Visitors: 6131