View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844-INSERTION-1 (Length: 91)
Name: NF0844-INSERTION-1
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844-INSERTION-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 8e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 8e-18
Query Start/End: Original strand, 36 - 85
Target Start/End: Complemental strand, 37162663 - 37162614
Alignment:
| Q |
36 |
atactatatggaatgtgtatggtttataatcgtacattatgatattcttc |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37162663 |
atactatatggaatgtgtatggtttataatcgtacattatgattttcttc |
37162614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 37162729 - 37162686
Alignment:
| Q |
1 |
gtgtttacattacatatatgccaaagttgatgtacatactatat |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37162729 |
gtgtttacattacatatatgccaaagttgatgtatatactatat |
37162686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25932 times since January 2019
Visitors: 1215