View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844-INSERTION-2 (Length: 182)
Name: NF0844-INSERTION-2
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 3817085 - 3816917
Alignment:
| Q |
1 |
ctttggttatcgattgcctatttgactctaatttatccatgcttttgttttctttaatattgaagtgacaaacatttgtgcatttaatttcggtcctcga |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3817085 |
ctttggtcatcgattgcctatttgactctaatttatccatgcttttgttttctttaatattgaagtgacaaacatttgtgcatttaatttcagtcctcga |
3816986 |
T |
 |
| Q |
101 |
tgtccatcctgattaaatattgagtttgcatactttgacttttggaattgatgtgcctgtgtttattgt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3816985 |
tgtccatcctgattaaatattgagtttgcatactttgacttttggaattgatgtgcctgtgtttattgt |
3816917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 68 - 174
Target Start/End: Original strand, 31052194 - 31052298
Alignment:
| Q |
68 |
acaaacatttgtgcatttaatttcggtcctcgatgtccatcctgattaaatattgagtttgcatactttgacttttggaattgatgtgcctgtgtttatt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31052194 |
acaaacatttgtgcatttaatttcggtcctcgatgtccatcttgattaaatattgagtttccatactttgacttttggaat--atgtgcctgtgtttatt |
31052291 |
T |
 |
| Q |
168 |
gttattt |
174 |
Q |
| |
|
||||||| |
|
|
| T |
31052292 |
gttattt |
31052298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University