View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_high_18 (Length: 296)
Name: NF0844_high_18
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 52 - 231
Target Start/End: Original strand, 7564724 - 7564903
Alignment:
| Q |
52 |
gagaaaagaagataagggtgaatgtatgatataattacnnnnnnnnnnattatcaaatgatgaagaaaacaatgaacgttaccaaacatgtccattgtag |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7564724 |
gagaaaagaagataagggtgaatgtatgatataattacttttttttttattatcaaatgatgaagaaaacaatgaacgttaccaaacatgtccattgtag |
7564823 |
T |
|
| Q |
152 |
gagtattggagaaagaattgagctttcaattgttataggcattgatgtactggtttcgagatagtgatagtgatgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7564824 |
gagtattggagaaagaattgagctttcaattgttataggcattgatgtactggtttcgagatagtgatagtgatgatgtc |
7564903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3651 times since January 2019
Visitors: 6174