View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_high_28 (Length: 253)
Name: NF0844_high_28
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_high_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 107 - 174
Target Start/End: Original strand, 28182935 - 28183002
Alignment:
| Q |
107 |
taaagtagctaacttgcctggctggtatttcaaagatgggtaccttcctgaccactaacattgttacc |
174 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28182935 |
taaagtagctaaattgcccgactggtatttcaaagattggtaccttcctgaccactaacattgttacc |
28183002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 29515418 - 29515370
Alignment:
| Q |
126 |
ggctggtatttcaaagatgggtaccttcctgaccactaacattgttacc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29515418 |
ggctggtatttcaaagatgggtaccttccggaccactaacattgttacc |
29515370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University