View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_high_31 (Length: 252)
Name: NF0844_high_31
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0844_high_31 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 34029111 - 34029346
Alignment:
Q |
30 |
gaacttagacgtaccatcttatgtcaaaatctttatatattagatctacgattcatctcacttatattttgttaatcaatttcttattcacacataatat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34029111 |
gaacttagacgtaccatcttatgtcaaaatctttatatattagatctacgattcatct--cttatattttgttaatcaatttcttattcacacataatat |
34029208 |
T |
 |
Q |
130 |
atcaacccaatttccttaatcattcattcaaatatatgtttgtaaacatat----------------gtatgtatgataaaatagattgattcattgttt |
213 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
34029209 |
atcaacccaattt-cttaatcattcattcaaatatatgtttgtaaacatatgtatgtatgtatgtacgtatgtatgataaaatagattgattcattgttt |
34029307 |
T |
 |
Q |
214 |
aaactttgatgctaccaataccaaatcatgttttcattt |
252 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34029308 |
aaactttgatgctaccaataccaaatcatgttttcattt |
34029346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University