View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_26 (Length: 422)
Name: NF0844_low_26
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-122; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 3708214 - 3708475
Alignment:
| Q |
1 |
atgtcatacacggagcattggcaacagaaacttttaggcagca-gctaatttgttcaaacaatcaaagtaacaaatacgacgttctagttgctagcgatg |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
3708214 |
atgtcatacacggagcattgccaacagaaacttttaggcagcaagctgatttgttcaaacaatcaaagtaacaaatacgacat-ctagttgctagtgatg |
3708312 |
T |
 |
| Q |
100 |
cagtggggatggaactgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaatattcttcatgtactggtgtcacaagt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
3708313 |
cagtggggatggaactgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaaaattcttcgtgtactggtgtcacaagt |
3708412 |
T |
 |
| Q |
200 |
tatttgcaagaagagccggttgaagaggatgcctttatctcgatggactcaccacaaccttgc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3708413 |
tatttgcaagaagagccggttgaagaggatgcctttatctcgatggactcaccacaaccttgc |
3708475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 3702295 - 3702360
Alignment:
| Q |
114 |
ctgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaatattctt |
179 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
3702295 |
ctgaacctcaacattcaaagggtgattttcagtagcctttcgaagtacaatggtggcaaaattctt |
3702360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 203 - 247
Target Start/End: Original strand, 3702375 - 3702419
Alignment:
| Q |
203 |
ttgcaagaagagccggttgaagaggatgcctttatctcgatggac |
247 |
Q |
| |
|
||||| ||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
3702375 |
ttgcaggaagagctggtagaagaggatgcctttatcccgatggac |
3702419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 10 - 180
Target Start/End: Complemental strand, 3520504 - 3520334
Alignment:
| Q |
10 |
acggagcattggcaacagaaacttttaggcagca-gctaatttgttcaaacaatcaaagtaacaaatacgacgttctagttgctagcgatgcagtgggga |
108 |
Q |
| |
|
||||||| ||| || |||| ||| ||||||||| |||||||||||||| | |||||||||| |||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
3520504 |
acggagctttgccaccagagactcgtaggcagcaagctaatttgttcaa-cgatcaaagtaatgaatatgacgttctagtagctagtgatgcagtgggga |
3520406 |
T |
 |
| Q |
109 |
tggaactgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaatattcttc |
180 |
Q |
| |
|
||| || || || |||||| ||||||||||||| |||| |||||| |||||||| |||||||| ||||||| |
|
|
| T |
3520405 |
tgggccttaaccttaacattcgaagggtgatttttaataacctttcaaagtacaacggtgacaaaattcttc |
3520334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University