View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0844_low_26 (Length: 422)

Name: NF0844_low_26
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0844_low_26
NF0844_low_26
[»] chr3 (3 HSPs)
chr3 (1-262)||(3708214-3708475)
chr3 (114-179)||(3702295-3702360)
chr3 (203-247)||(3702375-3702419)
[»] chr6 (1 HSPs)
chr6 (10-180)||(3520334-3520504)


Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-122; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 3708214 - 3708475
Alignment:
1 atgtcatacacggagcattggcaacagaaacttttaggcagca-gctaatttgttcaaacaatcaaagtaacaaatacgacgttctagttgctagcgatg 99  Q
    |||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| | ||||||||||| ||||    
3708214 atgtcatacacggagcattgccaacagaaacttttaggcagcaagctgatttgttcaaacaatcaaagtaacaaatacgacat-ctagttgctagtgatg 3708312  T
100 cagtggggatggaactgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaatattcttcatgtactggtgtcacaagt 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||    
3708313 cagtggggatggaactgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaaaattcttcgtgtactggtgtcacaagt 3708412  T
200 tatttgcaagaagagccggttgaagaggatgcctttatctcgatggactcaccacaaccttgc 262  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3708413 tatttgcaagaagagccggttgaagaggatgcctttatctcgatggactcaccacaaccttgc 3708475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 3702295 - 3702360
Alignment:
114 ctgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaatattctt 179  Q
    ||||| |||||||||  |||||||||||||| ||||||||||||||||||||||| ||| ||||||    
3702295 ctgaacctcaacattcaaagggtgattttcagtagcctttcgaagtacaatggtggcaaaattctt 3702360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 203 - 247
Target Start/End: Original strand, 3702375 - 3702419
Alignment:
203 ttgcaagaagagccggttgaagaggatgcctttatctcgatggac 247  Q
    ||||| ||||||| ||| |||||||||||||||||| ||||||||    
3702375 ttgcaggaagagctggtagaagaggatgcctttatcccgatggac 3702419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 10 - 180
Target Start/End: Complemental strand, 3520504 - 3520334
Alignment:
10 acggagcattggcaacagaaacttttaggcagca-gctaatttgttcaaacaatcaaagtaacaaatacgacgttctagttgctagcgatgcagtgggga 108  Q
    ||||||| ||| || |||| |||  ||||||||| |||||||||||||| | ||||||||||  |||| ||||||||||| ||||| |||||||||||||    
3520504 acggagctttgccaccagagactcgtaggcagcaagctaatttgttcaa-cgatcaaagtaatgaatatgacgttctagtagctagtgatgcagtgggga 3520406  T
109 tggaactgaatctcaacatttgaagggtgattttcaatagcctttcgaagtacaatggtgacaatattcttc 180  Q
    |||  || || || |||||| ||||||||||||| |||| |||||| |||||||| |||||||| |||||||    
3520405 tgggccttaaccttaacattcgaagggtgatttttaataacctttcaaagtacaacggtgacaaaattcttc 3520334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University