View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_39 (Length: 344)
Name: NF0844_low_39
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 30 - 213
Target Start/End: Complemental strand, 4563128 - 4562946
Alignment:
| Q |
30 |
atattgttagaacatcaacccgattgaaaatgcaatcagcgaaa---acaatacacaatgttcggacannnnnnnnnnnnnnnnngaaggaaacaaagtt |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4563128 |
atattgttagaatatcaacccgattgaaaatgcaatcagcgaaatacacaatacacaatgttcggacatttttttttttt-----gaaggaaacaaagtt |
4563034 |
T |
|
| Q |
127 |
aggacaattgtgtttacgtttgttgggtcggtccaaca-atgtccatgtttacggcgaatttttatatgagactctttaaagctcgta |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4563033 |
cggacaattgtgtttacgtttgttggatcggtccaacacatgtccatgtttaaggcgaatttttatatgagactctttaaagctcgta |
4562946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 266 - 328
Target Start/End: Complemental strand, 4562887 - 4562825
Alignment:
| Q |
266 |
gatacaaaatcataaattaagctaataacagcagtgttaaaactcttaggaagaatttaccgt |
328 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4562887 |
gatacaaaatcataaattaagctaatgacagcagtgttaaaactcttaggaagaacttaccgt |
4562825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1041 times since January 2019
Visitors: 6135