View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0844_low_40 (Length: 327)

Name: NF0844_low_40
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0844_low_40
NF0844_low_40
[»] chr7 (5 HSPs)
chr7 (36-272)||(25084454-25084690)
chr7 (35-162)||(25062821-25062948)
chr7 (35-163)||(25090716-25090844)
chr7 (38-159)||(25071524-25071645)
chr7 (200-263)||(25071701-25071764)


Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 36 - 272
Target Start/End: Original strand, 25084454 - 25084690
Alignment:
36 aaaggttattacatgttgatcttgatttgtgcctcattgatgggaggattactgagaaatataattcgagtcttgtctgatagactctgccaatcattac 135  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
25084454 aaaggttattacatgttgatcttgatttgtgcctcattgatgggaggattactgagcaatataattcgagtcttgtctgatagactctgccaatcattac 25084553  T
136 gaattatgtcaaaattgacattcataaatattttttaaacagcaaaaacaaaattaacattgataaatatgagatgaaaactaaatttcatacacaaatg 235  Q
    |||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25084554 gaattatgtcaaaattgacattcataaatattttttgaatagtaaaaacaaaattaacattgataaatatgagatgaaaactaaatttcatacacaaatg 25084653  T
236 acacaagaatttcataaagtatgaaacacaattatta 272  Q
    |||||||||||||||||||||||||||||||||||||    
25084654 acacaagaatttcataaagtatgaaacacaattatta 25084690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 35 - 162
Target Start/End: Original strand, 25062821 - 25062948
Alignment:
35 caaaggttattacatgttgat-cttgatttgtgcctcattgatgggaggattactgagaaatataattcgagtcttgtctgatagactctgccaatcatt 133  Q
    ||||||||||||||||| ||| ||| ||||||||||||||||| ||||||||||||||||||||||| ||||| || | |||||| ||||| |||| |||    
25062821 caaaggttattacatgt-gatgcttcatttgtgcctcattgattggaggattactgagaaatataatacgagttttctgtgataggctctgtcaattatt 25062919  T
134 acgaattatgtcaaaattgacattcataa 162  Q
    | |||||||||||||||| ||||||||||    
25062920 aggaattatgtcaaaattaacattcataa 25062948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 35 - 163
Target Start/End: Original strand, 25090716 - 25090844
Alignment:
35 caaaggttattacatgttgatcttgatttgtgcctcattgatgggaggattactgagaaatataattcgagtcttgtctgatagactctgccaatcatta 134  Q
    |||| ||||||||||||||| ||| | |||||||||| ||||||||||| |||||||||||||||| ||| |||||| ||| || |||||  ||| ||||    
25090716 caaaagttattacatgttgaactttaattgtgcctcactgatgggaggactactgagaaatataatccgaatcttgtgtgacaggctctgttaattatta 25090815  T
135 cgaattatgtcaaaattgacattcataaa 163  Q
    | ||||||||||| ||| |||||||||||    
25090816 caaattatgtcaagattaacattcataaa 25090844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 25071524 - 25071645
Alignment:
38 aggttattacatgttgatcttgatttgtgcctcattgatgggaggattactgagaaatataattcgagtcttgtctgatagactctgccaatcattacga 137  Q
    ||||||||||||||||  ||| ||||||||||||||||| |||||||||||||||| |||||| ||||| || | ||| || ||||  | ||||||| ||    
25071524 aggttattacatgttgtgcttcatttgtgcctcattgattggaggattactgagaagtataatccgagttttctgtgacaggctctatccatcattagga 25071623  T
138 attatgtcaaaattgacattca 159  Q
    |||||||| ||||| |||||||    
25071624 attatgtcgaaattaacattca 25071645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 200 - 263
Target Start/End: Original strand, 25071701 - 25071764
Alignment:
200 aaatatgagatgaaaactaaatttcatacacaaatgacacaagaatttcataaagtatgaaaca 263  Q
    |||||| ||| ||||||| ||||| |||||||||  ||||||||||||||| ||||| ||||||    
25071701 aaatatcagacgaaaacttaattttatacacaaagtacacaagaatttcatgaagtaggaaaca 25071764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3595 times since January 2019
Visitors: 6174