View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_42 (Length: 319)
Name: NF0844_low_42
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 166 - 300
Target Start/End: Complemental strand, 45209645 - 45209513
Alignment:
| Q |
166 |
gaaaccttatctttgcaatttatatacaactcttattgtatcttgttttgaattctcccccacttcatttacatagacatctttgagtatatgagagata |
265 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45209645 |
gaaaccttatctttgcaatttata--caactcatattgtatcttgttttgaattctcccccacttcatttacatagacatctttgagtatatgagagata |
45209548 |
T |
|
| Q |
266 |
acctctagcttattagcatcctcaacaacacatag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45209547 |
acctctagcttattagcatcctcaacaacacatag |
45209513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 45209811 - 45209724
Alignment:
| Q |
1 |
tataaatcaattgctatgaaatttgctaagatagaagctgacatggtgagctagaatggaaaacaaaatagctttgtgttactcagac |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45209811 |
tataaatcaattgctatgaaatttgctaagatagaagctgacatggtgagctagaatggaaaacaaaatagctttgtgttactcagac |
45209724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 167 - 300
Target Start/End: Complemental strand, 27749659 - 27749531
Alignment:
| Q |
167 |
aaaccttatctttgcaatttatatacaactcttattgtatcttgttttgaattctcccccacttcatttacatagacatctttgagtatatgagagataa |
266 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| | ||||||||||||| ||||||||| ||||||||| ||||| || |
|
|
| T |
27749659 |
aaaccttatctttgcaatttata--caactcttat---atcttgttttgaattcttctccacttcatttacttagacatctatgagtatatcagagacaa |
27749565 |
T |
|
| Q |
267 |
cctctagcttattagcatcctcaacaacacatag |
300 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||| |
|
|
| T |
27749564 |
cccccagcttattagcatcctcaacaacacatag |
27749531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 27750218 - 27750159
Alignment:
| Q |
1 |
tataaatcaattgctatgaaatttgctaagatagaagctgacatggtgagctagaatggaa |
61 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
27750218 |
tataaatcaattgctatgaaatttgc-aagatagaagctgacatggtgagcaagaatggaa |
27750159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 167 - 257
Target Start/End: Original strand, 675003 - 675091
Alignment:
| Q |
167 |
aaaccttatctttgcaatttatatacaactcttattgtatcttgttttgaattctcccccacttcatttacatagacatctttgagtatat |
257 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| || |||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
675003 |
aaacctcatctttgcaatttata--caactcttgttatatcttgttttgaattctcctccacttcatttacttagacatctttgagtatat |
675091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 674851 - 674933
Alignment:
| Q |
1 |
tataaatcaattgctatgaaatttgctaagatagaagctgacatggtgagctagaatggaaaacaaaatagctttgtgttactc |
84 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||| || ||||| |||||| |||||| |
|
|
| T |
674851 |
tataaaccaattgctatgaaatttgc-aagatagaagctgacatggtgagcaagaatggaagaccaaatatctttgtattactc |
674933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 3 - 70
Target Start/End: Original strand, 22352485 - 22352552
Alignment:
| Q |
3 |
taaatcaattgctatgaaatttgctaagatagaagctgacatggtgagctagaatggaaaacaaaata |
70 |
Q |
| |
|
|||||||||||||||| |||||| || |||||||| ||||||||||| | ||||||||| || ||||| |
|
|
| T |
22352485 |
taaatcaattgctatgcaatttggtacgatagaagttgacatggtgaacaagaatggaagaccaaata |
22352552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3034 times since January 2019
Visitors: 6168