View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_43 (Length: 319)
Name: NF0844_low_43
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 84 - 308
Target Start/End: Original strand, 11279046 - 11279270
Alignment:
| Q |
84 |
ggttccaattaagacactgctaattgatggaaactgtagagtggaggatagaggattgaagacgcatcatggacatgtgagttctgatatactaatcaga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11279046 |
ggttccaattaagacactgctaattgatggaaactgtagagtggaggatagaggattgaagacgcatcatggacatgtgagttctgatatactaatcaga |
11279145 |
T |
 |
| Q |
184 |
ggaggtaatcctaatcatacaattgcaatggattatcaggatttgatgtaagtaaacacaatcttgacaatccatatatggttgtgtggtcaagattatc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11279146 |
ggaggtaatcctaatcatacaattgcaatggattatcaggatttgatgtaagtaaacacaatcttgacaatccatatatggttgtgtggtcaagattatc |
11279245 |
T |
 |
| Q |
284 |
tcctctcgtatcgttttatgttcat |
308 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
11279246 |
tcctctcgtattgttttatgttcat |
11279270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University