View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_48 (Length: 301)
Name: NF0844_low_48
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0844_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 68 - 251
Target Start/End: Complemental strand, 9709306 - 9709123
Alignment:
Q |
68 |
gatgtttcccagcttttaagaacatgaagacgctaaagtgtgaaaaatccgaatcagaaaacagcagccataatgagcacgtatctgcaacaacgcctca |
167 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9709306 |
gatgtttcccagcttttaagaacatgaagacgctaaagtgtgaaaaatccgaatcagaaaacagcagccataatgagcacgtatctgcaacaacgcctca |
9709207 |
T |
 |
Q |
168 |
acttcaagcttctcgctcgttgcactctgagcctcgaagttctatggctagtatgaaatcctttaaccgagttgccagcaacag |
251 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
9709206 |
acttcaagcttctcgctcgttgcactctgatcctcgaagttctatggctagtatgaaatcccttaaccgagttgccaacaacag |
9709123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University