View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_54 (Length: 291)
Name: NF0844_low_54
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0844_low_54 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 228 - 291
Target Start/End: Original strand, 9440551 - 9440614
Alignment:
Q |
228 |
tacagctaatccaaacacaagttgtgtcttgaacaaaagacataacaatcaatttatgtgtttc |
291 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
9440551 |
tacagctaatccaaacacaagttgtgtcttgaacaaaagacataacaatcaagctatgtgtttc |
9440614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2312 times since January 2019
Visitors: 6161