View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0844_low_54 (Length: 291)

Name: NF0844_low_54
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0844_low_54
NF0844_low_54
[»] chr2 (1 HSPs)
chr2 (228-291)||(9440551-9440614)


Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 228 - 291
Target Start/End: Original strand, 9440551 - 9440614
Alignment:
228 tacagctaatccaaacacaagttgtgtcttgaacaaaagacataacaatcaatttatgtgtttc 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
9440551 tacagctaatccaaacacaagttgtgtcttgaacaaaagacataacaatcaagctatgtgtttc 9440614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2312 times since January 2019
Visitors: 6161