View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_59 (Length: 279)
Name: NF0844_low_59
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 40 - 244
Target Start/End: Original strand, 3098057 - 3098261
Alignment:
| Q |
40 |
atgaatgcataatccatgtttgggcatacggtgaccatgaacttttgcctgccaaacacagtgtcaaacttcttatttatctgcaagaataacaactata |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098057 |
atgaatgcataatccatgtttgggcatacggtgaccatgaacttttgcctgctaaacacagtgtcaaacttcttatttatctgcaagaataacaactata |
3098156 |
T |
|
| Q |
140 |
gatttaaataaaaagttatttttgtatgaaataatttgaagcnnnnnnnnnnnctttatgtatctattcaatagaggaagttgttagttgacatgcatca |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098157 |
gatttaaataaaaagttatttttgtatcaaataatttgaagcaaaaaaataaactttatgtatctattcaatagaggaagttgttagttgacatgcatca |
3098256 |
T |
|
| Q |
240 |
tttca |
244 |
Q |
| |
|
||||| |
|
|
| T |
3098257 |
tttca |
3098261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 134
Target Start/End: Original strand, 3082748 - 3082842
Alignment:
| Q |
40 |
atgaatgcataatccatgtttgggcatacggtgaccatgaacttttgcctgccaaacacagtgtcaaacttcttatttatctgcaagaataacaa |
134 |
Q |
| |
|
|||||||||||||| |||||||| | || |||||||||||||||| ||||| || | |||| ||| |||||||||||||||||| ||| |||| |
|
|
| T |
3082748 |
atgaatgcataatcgatgtttggagacacagtgaccatgaacttttccctgctaacaatagtgccaagcttcttatttatctgcaataatcacaa |
3082842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 134
Target Start/End: Original strand, 3091977 - 3092071
Alignment:
| Q |
40 |
atgaatgcataatccatgtttgggcatacggtgaccatgaacttttgcctgccaaacacagtgtcaaacttcttatttatctgcaagaataacaa |
134 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||| |||| ||||| |||| ||| ||||| ||||||| ||| ||| |||| |
|
|
| T |
3091977 |
atgaatgcataatccatgttcgaacatacggtaaccatgaacttttttctgctaaacatagtgccaagcttctggtttatctacaataattacaa |
3092071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1216 times since January 2019
Visitors: 6138