View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_63 (Length: 275)
Name: NF0844_low_63
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 104 - 248
Target Start/End: Complemental strand, 44948577 - 44948431
Alignment:
| Q |
104 |
ctaggaatatgtatatttgatgggtggttcaactcttgccttttgcgaaagtgaattcagttgaagaggagaaacaagtttgtgccgagaaggatatgc- |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948577 |
ctaggaatatgtatatttgatgggtggttcaactcttgccttttgcgaaagtgaattcagttgaagaggagaaacaagtttgtgccgagaaggatatgca |
44948478 |
T |
|
| Q |
203 |
-agagttgtcaaactgtggaattgaggcattcaagttgttggctaag |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948477 |
aagagttgtcatactgtggaattgaggcattcaagttgttggctaag |
44948431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 250
Target Start/End: Original strand, 11450335 - 11450382
Alignment:
| Q |
203 |
agagttgtcaaactgtggaattgaggcattcaagttgttggctaagaa |
250 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
11450335 |
agagttgtcatattgtggatttgaggcattcaagttgttggctaagaa |
11450382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 256
Target Start/End: Original strand, 6971614 - 6971654
Alignment:
| Q |
216 |
tgtggaattgaggcattcaagttgttggctaagaataatct |
256 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
6971614 |
tgtggatttgaggcattcaagatgttggctaagaattatct |
6971654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2014 times since January 2019
Visitors: 6156