View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_64 (Length: 268)
Name: NF0844_low_64
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 47 - 241
Target Start/End: Original strand, 47025691 - 47025884
Alignment:
| Q |
47 |
ataaggtcatgggactagcacatctaacaaagatttccactcttttaagcagatcaaacactttattagaacttttgtttgtcttatacgatcttttgta |
146 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
47025691 |
ataaggtcctgggactagcccatctaacaaagattgccactcttttaagcagatcaaacactttattagaactcttgtttgtcttatacgaacttttgta |
47025790 |
T |
|
| Q |
147 |
gataaaagactattttagtttttgaatttatatttatgataaaaagttgtgatgtagttttagtaagagacatgaattttagtttttatttcttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
47025791 |
gataaaagactattttagtttttgaatttatatttatgataaaaagttgtgatgt-ggtttagtaagagacatgaatttcagtttttgtttcttt |
47025884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3511 times since January 2019
Visitors: 6174