View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0844_low_73 (Length: 251)

Name: NF0844_low_73
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0844_low_73
NF0844_low_73
[»] chr3 (1 HSPs)
chr3 (1-243)||(34139949-34140191)


Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34139949 - 34140191
Alignment:
1 caccacttggtgatgggaattttagttatttcaagcaaattgttgattttcataagattgaatcaactgcatgggtttttagctttggtgattttaataa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34139949 caccacttggtgatgggaattttagttatttcaagcaaattgttgattttcataagattgaatcaactgcatgggtttttagctttggtgattttaataa 34140048  T
101 aagggaagtttgggaggcattggctactttgttttatgttgatgtaattgctatgactggtataatgtatactatggccgagattggtgagtttgtcgat 200  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34140049 aagggaagtttgggaggcattggctactttgttttatgtcgatgtaattgctatgactggtataatgtatactatggccgagattggtgagtttgtcgat 34140148  T
201 gaagaaggaaactttgaaggtgaatatatggcatatattgttg 243  Q
    |||||||||| ||||||||||||||||||||||||||||||||    
34140149 gaagaaggaagctttgaaggtgaatatatggcatatattgttg 34140191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University