View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_73 (Length: 251)
Name: NF0844_low_73
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34139949 - 34140191
Alignment:
| Q |
1 |
caccacttggtgatgggaattttagttatttcaagcaaattgttgattttcataagattgaatcaactgcatgggtttttagctttggtgattttaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139949 |
caccacttggtgatgggaattttagttatttcaagcaaattgttgattttcataagattgaatcaactgcatgggtttttagctttggtgattttaataa |
34140048 |
T |
|
| Q |
101 |
aagggaagtttgggaggcattggctactttgttttatgttgatgtaattgctatgactggtataatgtatactatggccgagattggtgagtttgtcgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34140049 |
aagggaagtttgggaggcattggctactttgttttatgtcgatgtaattgctatgactggtataatgtatactatggccgagattggtgagtttgtcgat |
34140148 |
T |
|
| Q |
201 |
gaagaaggaaactttgaaggtgaatatatggcatatattgttg |
243 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34140149 |
gaagaaggaagctttgaaggtgaatatatggcatatattgttg |
34140191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10324 times since January 2019
Visitors: 6096