View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_79 (Length: 224)
Name: NF0844_low_79
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0844_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 38058426 - 38058636
Alignment:
Q |
1 |
caaattcattttaatgtaagttctaaaacgttgcagctatacctatgatatatgatcacgtctattcagacacaaattctagactcatattaatgatctt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38058426 |
caaattcattttaatgtaagttctaaaacgttgcagctatacctatgatatatgatcacttctattcagacacaaattctagactcatattaatgatctt |
38058525 |
T |
 |
Q |
101 |
acttgtttttcactatctctccatacnnnnnnnttctgacttctgaggggactgtgcatctttacagtgcagaaaattatcaggatttccattcttttgt |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38058526 |
acttgtttttcactatctctccatacaaaaaatttctgacttctgaggggactgtgcatctttacagtgcagaaaattatcaggatttccattcttttgt |
38058625 |
T |
 |
Q |
201 |
caccacaggtt |
211 |
Q |
|
|
||||||||||| |
|
|
T |
38058626 |
caccacaggtt |
38058636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 38065563 - 38065618
Alignment:
Q |
153 |
tgtgcatctttacagtgcagaaaattatcaggatttccattcttttgtcaccacag |
208 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||| || ||||| |
|
|
T |
38065563 |
tgtgcatctttacagtgcagaaaattatcagtatttccattcttttgccatcacag |
38065618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University