View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_83 (Length: 214)
Name: NF0844_low_83
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0844_low_83 |
![](./plan/images/spacer.gif) | ![NF0844_low_83](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 23627818 - 23627958
Alignment:
Q |
1 |
ttttgtgatattttcaaagccctgaggagcctggacaaaggcaatttcatgtcccttctcttcatccatgaagaagcaaagtgcatctcttattgattga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23627818 |
ttttgtgatattttcaaagccctgaggagcctgcacaaaggcaatttcatgtcccttctcttcatccatgaagaagcaaagtgcatctcttattgattga |
23627917 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
gaattgtttgagtacatgtcacaatctacattcagtattat |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
23627918 |
gaattgtttgagtacatgtcacaatctacattcagaattat |
23627958 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 23640428 - 23640568
Alignment:
Q |
1 |
ttttgtgatattttcaaagccctgaggagcctggacaaaggcaatttcatgtcccttctcttcatccatgaagaagcaaagtgcatctcttattgattga |
100 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23640428 |
ttttgtgatattttcaaagccctgaggagtctgcacaaaggcaatttcatgtcccttctcttcatccatgaagaagcaaagtgcatctcttattgattga |
23640527 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
gaattgtttgagtacatgtcacaatctacattcagtattat |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
23640528 |
gaattgtttgagtacatgtcacaatctacattcagaattat |
23640568 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 10 - 132
Target Start/End: Original strand, 23654354 - 23654476
Alignment:
Q |
10 |
attttcaaagccctgaggagcctggacaaaggcaatttcatgtcccttctcttcatccatgaagaagcaaagtgcatctcttattgattgagaattgttt |
109 |
Q |
|
|
|||||||||| |||| |||| ||| ||||| ||||||||||| || ||||||||||||||||| | || || | ||||||||| |||| ||||||||| |
|
|
T |
23654354 |
attttcaaaggcctgtggagactgcacaaaagcaatttcatggcctttctcttcatccatgaaataacagagagaatctcttatagattctgaattgttt |
23654453 |
T |
![](./plan/images/spacer.gif) |
Q |
110 |
gagtacatgtcacaatctacatt |
132 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
23654454 |
gagtacatgtcacaatctacatt |
23654476 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7941 times since January 2019
Visitors: 1274