View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0844_low_84 (Length: 211)
Name: NF0844_low_84
Description: NF0844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0844_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 3641834 - 3641940
Alignment:
| Q |
5 |
tgttgttgcaagaatcaaattcacgatgtcaccggatcaaacttcat---atattttcactgatgttacctggtggctagaaggaatctatacaaatatc |
101 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3641834 |
tgttgttacaagaatcaaattcacgatgtcaccggatcaaacttcatcatatattttcactgatgttacctggtggctagaaggaatctatacaaataac |
3641933 |
T |
 |
| Q |
102 |
attaaat |
108 |
Q |
| |
|
||||||| |
|
|
| T |
3641934 |
attaaat |
3641940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University