View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0845_high_11 (Length: 286)

Name: NF0845_high_11
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0845_high_11
NF0845_high_11
[»] chr4 (1 HSPs)
chr4 (62-202)||(23041917-23042057)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 62 - 202
Target Start/End: Original strand, 23041917 - 23042057
Alignment:
62 taataatttacacaatcagtgtgtcatgtcatcacttttatagagtcaatgtcattagagtctaaaatcaaataatcttctaatggtaaatgaaatttca 161  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
23041917 taataatttacacaatcagtgtgtcatatcatcacttttatagagtcaatatcattagagtctaaaatcaaataatcttctaatggtaaaggaaatttca 23042016  T
162 aatttatttatagaggtaaatcaaaactcgctcaaataaca 202  Q
    |||| |||||||||| |||||||||||||||||||||||||    
23042017 aattaatttatagagataaatcaaaactcgctcaaataaca 23042057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University