View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_high_15 (Length: 260)
Name: NF0845_high_15
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0845_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 53124252 - 53124454
Alignment:
Q |
20 |
gaataatatcagcatacaagctttgggtctggcgtgttctagttccagattaaagccaatataacatacaaggagatcgggtatagatttagagactaga |
119 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53124252 |
gaataaaatcagcatacaagctttgggtctggcgtgttcaagttccagattaaagccaatataacatacaaggagatcgggtatagatttagagactaga |
53124351 |
T |
 |
Q |
120 |
atttatctaatattaataataaatataattgaggccgttcaaatcaaaatcgagggctaaccgtgatttcagagaaaagaaatatgagaacataacatta |
219 |
Q |
|
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53124352 |
atttatctaatattaataatagatataatttaggccgttcaaatcaaaatcgagggctaaccgtgatttcagagaaaagaaatatgagaacataacatta |
53124451 |
T |
 |
Q |
220 |
aat |
222 |
Q |
|
|
||| |
|
|
T |
53124452 |
aat |
53124454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University