View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0845_high_16 (Length: 252)

Name: NF0845_high_16
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0845_high_16
NF0845_high_16
[»] chr3 (1 HSPs)
chr3 (1-241)||(34432612-34432853)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 34432612 - 34432853
Alignment:
1 gttgttgatgatgagtttattggagagnnnnnnnngtgagaagatgaaaaggatgtgaacagattggagtgagagggaatttaacatgaatttaaggagt 100  Q
    |||||||||||||||||||||||||||        ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
34432612 gttgttgatgatgagtttattggagagaaaaaaaagtgagaagatgaaaaggatatgaacagattggagtgagagggaatttaacatgaatttaaggagt 34432711  T
101 aggagatgagagaagagannnnnnnnatttaatagataaataaatttaggtgagttgggctcattagagtccggacatgtctcaaagctc-aaaaaacgt 199  Q
    |||||||||||||||| |        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
34432712 aggagatgagagaagaaattttatttatttaatagataaataaatttaggtgagttgggctcattagagtccggacatgtctcaaagctcaaaaaaacgt 34432811  T
200 gttgacaaaaatacttgtagattacaccaacaaagtcttcat 241  Q
    ||||||||||||||||||||||||||||||||||||||||||    
34432812 gttgacaaaaatacttgtagattacaccaacaaagtcttcat 34432853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University