View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_high_16 (Length: 252)
Name: NF0845_high_16
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0845_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 34432612 - 34432853
Alignment:
Q |
1 |
gttgttgatgatgagtttattggagagnnnnnnnngtgagaagatgaaaaggatgtgaacagattggagtgagagggaatttaacatgaatttaaggagt |
100 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34432612 |
gttgttgatgatgagtttattggagagaaaaaaaagtgagaagatgaaaaggatatgaacagattggagtgagagggaatttaacatgaatttaaggagt |
34432711 |
T |
 |
Q |
101 |
aggagatgagagaagagannnnnnnnatttaatagataaataaatttaggtgagttgggctcattagagtccggacatgtctcaaagctc-aaaaaacgt |
199 |
Q |
|
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
34432712 |
aggagatgagagaagaaattttatttatttaatagataaataaatttaggtgagttgggctcattagagtccggacatgtctcaaagctcaaaaaaacgt |
34432811 |
T |
 |
Q |
200 |
gttgacaaaaatacttgtagattacaccaacaaagtcttcat |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34432812 |
gttgacaaaaatacttgtagattacaccaacaaagtcttcat |
34432853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3047 times since January 2019
Visitors: 6168