View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_high_18 (Length: 251)
Name: NF0845_high_18
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 228
Target Start/End: Complemental strand, 43861270 - 43861052
Alignment:
| Q |
10 |
agatgaagatgagattctttcttgtagcttctatggtaatattctgtttccttggaattagtgaaggaggcagcctcaggaagaatttctataagaagtc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43861270 |
agatgaagatgagattctttcttgtagcttctatggtaatattctgtttccttggaattagtgaaggaggcagcctcaggaagaatttctataagaagtc |
43861171 |
T |
|
| Q |
110 |
atgtcctcaagctgaggagattgttaagaacataaccctacaacatgtctcttcaaggcctgagctgccagccaagttgataagattgcattttcatgac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43861170 |
atgtcctcaagctgaggagattgttaagaacataaccctacaacatgtctcttcaaggcctgagctgccagccaagttgataagattgcattttcatgac |
43861071 |
T |
|
| Q |
210 |
tgttttgttagggtaaaca |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43861070 |
tgttttgttagggtaaaca |
43861052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3543 times since January 2019
Visitors: 6174