View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_24 (Length: 343)
Name: NF0845_low_24
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 69 - 314
Target Start/End: Original strand, 54329639 - 54329884
Alignment:
| Q |
69 |
tattgatcgtaaaaaagtgaaagcaaaatctagtagaaaatgtgaaggtgaaattttgtattgtgcaaaaagaaaatagaagaaagcgcgtaagaaaagg |
168 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54329639 |
tattgatcgtaaaaaaatgaaagcaaaatctagtagaaaatgtgaaggtgaaattttgtattgtgcaaaaagaaaatagaagaaagcgcgtaagaaaagg |
54329738 |
T |
|
| Q |
169 |
taaaggttgcttagtagcatttgattgattgattcacagaatcacagagagcgacctagtacctaaccatataagacttggtaacgcttttgtaacaagg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54329739 |
taaaggttgcttagtagcatttgattgattgattcacagaatcacagacagcgacctagtacctaaccatataagacttggtaacgcttttgtaacaagg |
54329838 |
T |
|
| Q |
269 |
aaatgtaatcaaaaaccaaatcgacctttccaattgtattgttttt |
314 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
54329839 |
aaatgtaatcaagaaccaaatcgacccttccaattgtattgttttt |
54329884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 54329526 - 54329576
Alignment:
| Q |
1 |
tgaaatgtgtgtgtctttgattgataaactaaccttgatgaaactgctaaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54329526 |
tgaaatgtgtgtgtctttgattgatacactaaccttgatgaaactgctaaa |
54329576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 75
Target Start/End: Original strand, 54329584 - 54329614
Alignment:
| Q |
45 |
tgctaaattgccgaatcctaacagtattgat |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54329584 |
tgctaaattgccgaatcctaacagtattgat |
54329614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 617 times since January 2019
Visitors: 6130