View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_29 (Length: 319)
Name: NF0845_low_29
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 5e-56; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 89 - 203
Target Start/End: Original strand, 9598756 - 9598870
Alignment:
| Q |
89 |
ctttttaacaagcctttcagtaacaacgttgtttagtggtttggttgtaacaaagattttttcctttcaaatccatactaccgaaacctaaattaggaag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9598756 |
ctttttaacaagcctttcagtaacaacgttgtttagtggtttggttgtaacaaagattttttcctttcaaatccatactaccaaaacctaaattaggaag |
9598855 |
T |
 |
| Q |
189 |
aagccaatcataatt |
203 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9598856 |
aagccaatcataatt |
9598870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 135 - 204
Target Start/End: Complemental strand, 33956884 - 33956815
Alignment:
| Q |
135 |
gtaacaaagattttttcctttcaaatccatactaccgaaacctaaattaggaagaagccaatcataatta |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | | ||||||||||||||||||| ||||||||||| |
|
|
| T |
33956884 |
gtaacaaagactttttcctttcaaatccataatgcaaaaacctaaattaggaagaaattaatcataatta |
33956815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 183 - 217
Target Start/End: Original strand, 9598883 - 9598917
Alignment:
| Q |
183 |
aggaagaagccaatcataattaatcaccttaaact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9598883 |
aggaagaagccaatcataattaatcaccttaaact |
9598917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 933474 - 933442
Alignment:
| Q |
133 |
ttgtaacaaagattttttcctttcaaatccata |
165 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
933474 |
ttgtaacatagattttttcctttcaaatccata |
933442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University