View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_30 (Length: 318)
Name: NF0845_low_30
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 31 - 318
Target Start/End: Original strand, 30510016 - 30510304
Alignment:
| Q |
31 |
agccaactgatcatttcattagttttttaaaaagggggaaacaagtttctttgggttacaacgaaaacaaagctgataaaaaggttaattgattttggtc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30510016 |
agccaactgatcatttcattagttttttaaaaagggggaaacaagtttctttgggttacaacgaaaacaaagctgataaaaaggttaattgattttggtc |
30510115 |
T |
|
| Q |
131 |
attcaaactcaaactctgatgtactaccactggggtctagtgcaagtagttggtgcgcaatgtgtgagtgctgtaaactctagggtatcgagttcaattc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30510116 |
attcaaactcaaactctgatgtactaccactggggtctagtgcaagtagttggtgcgcaatgtgtgagtgctgtaaactctagggtatcgagttcaattc |
30510215 |
T |
|
| Q |
231 |
ctactc-nnnnnnnnnnnnnntcaatctcggtgtggttttgcagcaatgattattttaaggatcatgattttgattaatccattatgac |
318 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30510216 |
ctactcaaaaataaaataaaatcaatctcggtgtggttttgcagcaatgattattttaaggatcatgattttgattaatccattatgac |
30510304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 156 - 234
Target Start/End: Complemental strand, 50275118 - 50275040
Alignment:
| Q |
156 |
accactggggtctagtgcaagtagttggtgcgcaatgtgtgagtgctgtaaactctagggtatcgagttcaattcctac |
234 |
Q |
| |
|
||||| ||||||||| ||||| || |||||||| |||||||||| | ||||| || |||||||||||| |||||||| |
|
|
| T |
50275118 |
accaccggggtctagcacaagttgtcggtgcgcagtgtgtgagtgttataaaccctgaggtatcgagttcgattcctac |
50275040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3241 times since January 2019
Visitors: 6172