View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_32 (Length: 310)
Name: NF0845_low_32
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 71 - 211
Target Start/End: Original strand, 42658554 - 42658694
Alignment:
| Q |
71 |
agtcgcaccgttgagcaaatttttgatgatttcaagagccgaagaactggaatcatcaaagccctaactgccggtataatttcttgttcaatctttttga |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
42658554 |
agtcgcaccgttgagcaaatttttgatgatttcaagagccgaagaactggaatcatcaaagccctaaccgtcggtataatttcttgttcaatctttttga |
42658653 |
T |
|
| Q |
171 |
attttggcaaaagggtttttcatttccttgcctgatctaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658654 |
attttggcaaaagggtttttcatttccttgcctgatctaca |
42658694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 308
Target Start/End: Original strand, 42658751 - 42658791
Alignment:
| Q |
268 |
gcactaaaacgtttggctttgttgtcatattgttggagatg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
42658751 |
gcactaaaacgtttggctttgttgtcatgttgttgcagatg |
42658791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 811 times since January 2019
Visitors: 6131