View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_35 (Length: 299)
Name: NF0845_low_35
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 68 - 290
Target Start/End: Original strand, 4400873 - 4401093
Alignment:
| Q |
68 |
ctattttgtgtcaaccgtgggtggatgatggtagttgagttaaaataaaagcatatttttgtatatggcttaaataaatgtcaaacccttaattaattca |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4400873 |
ctattttgtgtcaaccgtgggtggatgatggtagttgagttaaaataaaagcatatttttgtat--ggcttaaataaatgtcaaacccttaattaattca |
4400970 |
T |
 |
| Q |
168 |
acggcaattggagaaacaagaactgagaaaatctcgtgatgactttgtgatcaaccttgagaaacatgtgaagtgtgaaaatatatggctagaaaagttc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4400971 |
acggcaattggagaaacaagaactgagaaaatctcgtgatgactttgggatcaaccttgagaaacatgtgaagtgtgaaaatatatggctagaaaagttc |
4401070 |
T |
 |
| Q |
268 |
atatataactctcttatattatt |
290 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4401071 |
atatataactctcttatattatt |
4401093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 2106627 - 2106673
Alignment:
| Q |
1 |
tgacatgatttctttgttaaaaacaactatggaactatccctttctt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2106627 |
tgacatgatttctttgttaaaaacaactatggaactatccctttctt |
2106673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University