View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_37 (Length: 286)
Name: NF0845_low_37
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0845_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 62 - 202
Target Start/End: Original strand, 23041917 - 23042057
Alignment:
Q |
62 |
taataatttacacaatcagtgtgtcatgtcatcacttttatagagtcaatgtcattagagtctaaaatcaaataatcttctaatggtaaatgaaatttca |
161 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
23041917 |
taataatttacacaatcagtgtgtcatatcatcacttttatagagtcaatatcattagagtctaaaatcaaataatcttctaatggtaaaggaaatttca |
23042016 |
T |
 |
Q |
162 |
aatttatttatagaggtaaatcaaaactcgctcaaataaca |
202 |
Q |
|
|
|||| |||||||||| ||||||||||||||||||||||||| |
|
|
T |
23042017 |
aattaatttatagagataaatcaaaactcgctcaaataaca |
23042057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 820 times since January 2019
Visitors: 6131