View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_40 (Length: 272)
Name: NF0845_low_40
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0845_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 25 - 265
Target Start/End: Complemental strand, 32688124 - 32687884
Alignment:
Q |
25 |
catcaactatccccaaacatatgcgatcagtgaaccaagacgatacagaaaagttgaaacttggcaatcttgctctcaaccagctccaacgtggagatgt |
124 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
32688124 |
catcaactatccccaaacatatgcgatcagtgaaccaagacgatacagaaaagttgaaacttggcaatcttgctctcaaccagctccaacgtggaaatgt |
32688025 |
T |
 |
Q |
125 |
gcaattaagccgtcaatctaatacatccataaaatttactggaggtcaacaatattatgggttttaacccagtgtattagttcacgcaagtaatcatttt |
224 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32688024 |
gcaattaagccgtcaatctagtacatccataaaatttactggaggtcaacaatattatgggttttaacccagtgtattagttcacgcaagtaatcatttt |
32687925 |
T |
 |
Q |
225 |
tactaaaaagaagtatatgtaatctaatcagattttgttgg |
265 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32687924 |
tactaaaaagaagtatatgtaatctaatcagattttgttgg |
32687884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3367 times since January 2019
Visitors: 6172