View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_43 (Length: 262)
Name: NF0845_low_43
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 46680884 - 46680958
Alignment:
| Q |
1 |
caacttcaagaattagatggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacaggt |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46680884 |
caacttcaagaattagacggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacaggt |
46680958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 46676902 - 46676976
Alignment:
| Q |
1 |
caacttcaagaattagatggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacaggt |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46676902 |
caacttcaagaattagacggtgaatctgctaggctcgcagattactttgatgtgattacaggaactagcacaggt |
46676976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 2649574 - 2649527
Alignment:
| Q |
28 |
gctaggcttgcagattactttgatgtgattacaggaacaagcacaggt |
75 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2649574 |
gctaggcttgcaaattactttgatgtgattacaggaacaagcacaggt |
2649527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 6091163 - 6091105
Alignment:
| Q |
16 |
gatggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacagg |
74 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
6091163 |
gatggtgaagatgcaaggcttgcagattactttgatgtgatctcaggaacaagtacagg |
6091105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University