View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0845_low_54 (Length: 219)

Name: NF0845_low_54
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0845_low_54
NF0845_low_54
[»] chr5 (1 HSPs)
chr5 (1-100)||(24400938-24401037)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 24401037 - 24400938
Alignment:
1 tgctggttgttgatcacgtttattttacacacatgccataaggaaccaacaaccactcacactacccttcctttgtttttcaacaaaacactcacttacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||    
24401037 tgctggttgttgatcacgtttattttacacacatgccataaggaaccaacaaccacttacactacccttcctttgtttttcaacaaatcactcacttacc 24400938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University