View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_55 (Length: 219)
Name: NF0845_low_55
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0845_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 24401013 - 24401130
Alignment:
Q |
1 |
aaataaacgtgatcaacaaccagcaactaagggcactttagcaaataagcataagttggtaaatatcctgataacaataaaaatgagtttgtttgtattc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
24401013 |
aaataaacgtgatcaacaaccagcaactaagggcactttagcaaataagcataagttggtaaatat-ctgataacaataaaaatgagtttgtttgtattc |
24401111 |
T |
 |
Q |
101 |
tcagtctcaccggtctctg |
119 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
24401112 |
tcagtctcaccggtctctg |
24401130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University