View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_58 (Length: 204)
Name: NF0845_low_58
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 43311795 - 43311673
Alignment:
| Q |
1 |
ctgattactctctttctgatttggtcgcagttttacctgaagggttcttagatcgaacagctaggactggaagggtcattggatgggctcctcaggtcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43311795 |
ctgattactctctttctgatttggtcgcagttttacctgaagggttcttagatcgaacagctaggactggaagggtcattggatgggctcctcaggtcca |
43311696 |
T |
|
| Q |
101 |
agtactcgctcatccagcaacag |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43311695 |
agtactcgctcatccagcaacag |
43311673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 39487373 - 39487490
Alignment:
| Q |
1 |
ctgattactctctttctgatttggtcgcagttttacctgaagggttcttagatcgaacagctaggactggaagggtcattggatgggctcctcaggtcca |
100 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||||||||| ||||||||||||||| | ||| ||||||||| ||||||||||| | |||| ||| |
|
|
| T |
39487373 |
ctgattaccctctttctgatttggaatcggttttacctgaaggattcttagatcgaacaacagggattggaagggtaattggatgggcccaacaggccca |
39487472 |
T |
|
| Q |
101 |
agtactcgctcatccagc |
118 |
Q |
| |
|
| |||| ||||||||||| |
|
|
| T |
39487473 |
aatactagctcatccagc |
39487490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39461161 - 39461251
Alignment:
| Q |
1 |
ctgattactctctttctgatttggtcgcagttttacctgaagggttcttagatcgaacagctaggactggaagggtcattggatgggctcc |
91 |
Q |
| |
|
|||||||||||||| |||| |||| | |||||||| ||||||||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39461161 |
ctgattactctcttactgaattgggcttggttttacccgaagggttcttagatcggacagcagggattggaagggtcattggatgggctcc |
39461251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 39484171 - 39484228
Alignment:
| Q |
1 |
ctgattactctctttctgatttggtcgcagttttacctgaagggttcttagatcgaac |
58 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
39484171 |
ctgattactctctttatgatttgggtccggttttacctgaaggattcttagatcgaac |
39484228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1868 times since January 2019
Visitors: 6150