View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_60 (Length: 202)
Name: NF0845_low_60
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 7 - 126
Target Start/End: Original strand, 45129034 - 45129153
Alignment:
| Q |
7 |
gtaagttgcatctgatattagtccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatttcccaactgcaattca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45129034 |
gtaagttgcatctgatattagtccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatttcccaactgcaattca |
45129133 |
T |
|
| Q |
107 |
actttggtagcaacagctag |
126 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
45129134 |
actttggtatcaacagctag |
45129153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 7 - 103
Target Start/End: Original strand, 40280889 - 40280985
Alignment:
| Q |
7 |
gtaagttgcatctgatattagtccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatttcccaactgcaat |
103 |
Q |
| |
|
|||||||| ||||||||| | |||||| ||||| ||||| ||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
40280889 |
gtaagttgaatctgatatcaatccatgagaccagaagaactcagcccttgaattgaagtcagtggcatattctagaagtggatttcccaactgcaat |
40280985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 28 - 90
Target Start/End: Original strand, 6632284 - 6632346
Alignment:
| Q |
28 |
tccatgtgaccaaaagaattcagcccttgaattgaaatcagttgcatattctagaactggatt |
90 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||| ||||| |||||| |||||| ||||||||| |
|
|
| T |
6632284 |
tccatgagaccaaaagaactcagctcttgaattaaaatctgttgcaaattctaaaactggatt |
6632346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1967 times since January 2019
Visitors: 6152