View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0845_low_9 (Length: 448)
Name: NF0845_low_9
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0845_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 30 - 448
Target Start/End: Complemental strand, 30910183 - 30909763
Alignment:
| Q |
30 |
ctatggcggtgccatcttgaagaaagcctttgtagacttcgccataaccaccaatgccgaggaggcgatcggctgagaagtcgtttgtggctttcttgat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30910183 |
ctatggcggtgccatcttgaagaaagcctttgtagacttcaccataaccaccaatgccgaggaggcgatcggctgagaagtcgtttgtggctttcttgat |
30910084 |
T |
 |
| Q |
130 |
ctctttgccggtgaaaagtttggctgctctgccaccaccacttgcgtttaaaattccttcgcgctctttggctaggcgttgttgtgcttctaatatgcgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30910083 |
ctctttgccggtgaaaagtttggctgctctgccaccaccacttgcgtttaaaattccttcgcgctctttggctaggcgttgttgtgcttctaatatgcgt |
30909984 |
T |
 |
| Q |
230 |
ttgtgacgtttgtagagaagaaacgcaattgctgctaggattagtgcagctccaactccacatgttatacctgaatatagttgttgccatcaaattaaga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30909983 |
ttgtgacgtttgtagagaagaaacgcaattgctgctaggattagtgcagctccaactccacatgttatacctgaatatagttgttgccatcaaattaaga |
30909884 |
T |
 |
| Q |
330 |
gtgaa--tacaaaagaatgaatatgagagctcctaaagttctatatttcttgtttaaattttatttcaagatcttattctttcactatattttcttttac |
427 |
Q |
| |
|
||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30909883 |
gtgaatgtgcaaaagaatgaatatgagagctcctatagttctatatttcttgtttaaattttatttcaagatcttattctttcactatattttcttttac |
30909784 |
T |
 |
| Q |
428 |
aatgtttgaaaatggaaatta |
448 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30909783 |
aatgtttgaaaatggaaatta |
30909763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University